Home | CV | Databases | IMEG Seminars | MEP-online | People | Publications | SoftwareText only version


Databases


This page provides links to various Databases developed by members of the Nei laboratory as well as links to the journal abstracts.  Feel free to contact the laboratory of Masatoshi Nei with questions regarding the database information.


#mega
Title:B-chain gene data set for Takahashi, Rooney, Nei 2000 JH.

#HLADRB1_M11161      TTCTTGTGGCAGCTTAAGTTTGAATGTTTCTTCAATGGGACGGAGTTGAGATGCATCTATAACCAAGAGGAGTCCGTGCGCTTCGACAGCGACGTGGGGGAGTACCGGGCGGTTGAGCTGGGGCGGCCTGATGCCGAGTACTGGAACGACAAGCGGGGCCAGGTGGACAATTGCAGACACAACTACGGGGAGGTGCAGCGGCGAGAGCCTAAGGTGACTGTGCCTTCAAAGACCCAGCCCCAGCACCTCCTGGTCTGCAGTGGTTTCTATCCAGGCAGCATTGAAGTCAGGTGGTTCCGGAACGGCCAGGAAGAGAAGGCTGGGGTGGTGTCCACGGGCCTGATCCAGAATGGAGATTGGACCTTCCAGACCCTGGTGATGCTGGAAATAGTTCCTCGGAGTGGAGAGGTTTACACCTGCCAAGTGGAGCACCCAAGTGTGACGAGCCCTCTCACAGTGGAATGGAGAGCACGGTCTGAATCTGCACAGAGCAAGATGCTGAGTGGAGTCGGGGGCTTCGTGCTGGGCCTGCTCTTCCTTGGGGCCGGGCTGATCTACTTCAGGAATCAGAAA
#HLADRB3-0201        TTCTTGGAGCTGCTTAAGTCTGAGTGTTTCTTCAATGGGACGGAGTTCAGACACTTCCATAACCAGGAGGAGTACGCGCGCTTCGACAGCGACGTGGGGGAGTACCGGGCGGTGAGGCTGGGGCGGCCTGATGCCGAGTACTGGAACGACAAGCGGGGCCAGGTGGACAATTGCAGACACAACTACGGGGAGGTGCAGCGGCGACATCCTCAGGTGACTGTGCCTGCAAAGACCCAGCCCCAGCACCTCCTGGTCTGCAGTGGTTTCTATCCAGGCAGCATTGAAGTCAGGTGGTTCCGGAACGGCCAGGAAGAGAAGGCTGGGGTGGTGTCCACGGGCCTGATCCAGAATGGAGACTGGACCTTCCAGACCCTGGTGATGCTAGAAACATTTCCTCGGAGTGGAGAGGTTTACACCTGCCAAGTGGAGCACCCAAGCGTAACGAGCCCTCTCACAGTGGAATGGAGTGCACGGTCTGAATCTGCACAGAGCAAGATGCTGAGTGGAGTCGGGGGCTTCGTGCTGGGCCTGCTCTTCCTTGGGGCCGGGCTGATCTACTTCAGGAATCAGAAA
#HLADRB4-01011       TTCTTGGAGCAGGCTAAGTGTGAGTGTTTCCTCAATGGGACGGAGAACAGATACATCTATAACCAAGAGGAGTACGCGCGCTACAACAGTGACCTGGGGGAGTACCAGGCGGTGACGCTGGGGCGGCCTGACGCTGAGTACTGGAACGACAGGCGGGCCGAGGTGGACACCTGCAGATACAACTACGGGGAGGTGCAGCGGCGACAACCTAAGGTGACTGTGCCTTCAAAGACCCAGCCCCAGCACCTCCTGGTCTGCAATGGTTTCTATCCAGGCAGCATTGAAGTCAGGTGGTTCCGGAACAGCCAGGAAGAGAAGGCTGGGGTGGTGTCCACAGGCCTGATCCAGAATGGAGACTGGACCTTCCAGACCCTGGTGATGCTGGAAACAGTTCCTCGGAGTGGAGAGGTTTACACCTGCCAAGTGGAGCATCCAAGCATGATGAGCCCTCTCACGGTGCAATGGAGTGCACGGTCTGAATCTGCACAGAGCAAGATGCTGAGTGGAGTCGGGGGCTTTGTGCTGGGCCTGCTCTTCCTTGGGACAGGGCTGATCTACTTCAGGAATCAGAAA
#HLADRB5-0101        TTCTTGCAGCAGGATAAGTATGAGTGTTTCTTCAACGGGACGGAGTTCAGAGACATCTATAACCAAGAGGAGGACTTGCGCTTCGACAGCGACGTGGGGGAGTACCGGGCGGTGACGCTGGGGCGGCCTGACGCTGAGTACTGGAACGACAGGCGCGCCGCGGTGGACACCTGCAGACACAACTACGGGGAGGTGCAGCGGCGAGAGCCTAAGGTGACTGTGCCTGCAAGGACCCAGACCCAGCACCTCCTGGTCTGCAATGGTTTCTATCCAGGCAGCATTGAAGTCAGGTGGTTCCGGAACAGCCAGGAAGAGAAGGCTGGGGTGGTGTCCACAGGCCTGATTCAGAATGGAGACTGGACCTTCCAGACCCTGGTGATGCTGGAAACAGTTCCTCGAAGTGGAGAGGTTTACACCTGCCAAGTGGAGCACCCAAGCGTGACGAGCCCTCTCACAGTGGAATGGAGAGCACAGTCTGAATCTGCACAGAGCAAGATGCTGAGTGGAGTCGGGGGCTTTGTGCTGGGCCTGCTCTTCCTTGGGGCCGGGCTAATCTACTTCAAGAATCAGAAA
#HLADRB6-0201        TTCTTGGAGCAGGCTAAGTGTGAGTGTATCTTCAATGGGATGAAGTACAGATACATCCATAAACGGGAGGAGAACCTGCGCTTCGACAGCAACGTGGAGGAGTTCCAGGCAGTTACGCTGGGGCGGCCTGTCGCAGAGAACTGGAACGGCAAGCGGGACAAGATGGACGACTGCAGATACAATTACGGGGAGGTGCAGCCGCGACATCCTAAGGTGACTGTGCCTGCAAAGACCCAGCCCCATCACCCCCTGGTCGGCAGTGGTTTCTATCCAGGCAGCATTAAAGTCAGGTGGTTCCAGAATGGTCAGGAAGAGAAGGCTGCGGTGGTCTCCATAGGCCTGATCCAGAATGGAGATTGGACCTTCCAGACCCTGGTGATGCTGGAAACAGTTCCTCGGAGTGGAGAGGTTTACACCTGCCAAGTGGAGCATCCAAGCGTGACGAGCCCTCTCACAGTGCAATGGAGTACACGGACTGAATCTGCACAGAGCAAGATGCTGAGTGGAGTCGGGGGCTTTGTGCTGGGCCTGCTCTTCCTTGGGACAGGGCTGATCTACTTCAGGAATCAGAAA
#GorillaDRB1_M77154  TTCTTGGAGTACTCTACGGGTGAGTGTTTCTTCAATGGGACGGAGTTCAGATACTTCTACAACCAAGAGGAGTACGTGCGCTTCGACAGCGACGTGGGGGAGTACCGGGCGGTGACGCTGGGGCGGCCTGATGCCGAGTACTGGAACGACAGGCGGGCCTCGGTGGACACCTGCAGACACAACTACGGGGAGGTGCAGCGGCGACAACCTAAGGTGACTGTGCCTTCAAGGACCCAACTCCAGCACCTCCTGGTCTGTAGTGGTTTCTATCCAGGCAGCATTGAAGTCAGGTGGTTCCGGAATGGCCAGGAAGAGAAGGCTGGGGTGGTGTCCACAGGCCTGATCCAGAATGGAGACTGGACCTTCCAGACCCTGGTGATGCTGGAAACAGTTCCTCGGAGTGGAGAGGTTTACACCTGCCAAGTGGAGCACCCAAGCGTGACAAGCCCTCTCACAGTGGAATGGAAAGCACGGTCTGAATCTGGACAGAGCAAGATGCTGAGTGGAGTCGGGGGCTTTGTGCTGGGCCTGCTCTTCCTTGGGGCTGGGCTGATCTACTTCAGGAATCAGAAA
#GorillaDRB3_M77153  TTCTTGGAGCTGCGTAAGTCTGAGTGTTTCTTCAATGGGACGGAGTACAGATACTTCCATAACCAAGAGGAGTTCGTGCGCTTCGACAGCGACGTGGGGGAGTACCGGGCGGTGACGCTGGGGCGGCCTGTCGCCGAGTACTGGAACGACAAGCGGGGCCGGGTGGACAATTGCAGACACAACTACGGGGAGGTGCAGCGGCGACATCCTCAGGTGACTGTGCCTGCAAAGACTCAGCCCCAGCACCTCCTGGTCTGCAGTGGTTTCTATCCAGGCAGCATTGAAGTCAGGTGGTTCCAGAACGGCCAGGAAGAGAAGGCTGGGGTGGTGTCCACGGGCCTGATCCAGAATGGAGACTGGACCTTCCAGACCCTGGTGATGCTAGAAACAGTTCCTCGGAGTGGAGAGGTTTATACCTGCCAAGTGGAGCAGCCAAGCGTAACGAGCCCTCTCACAGTGGAATGGAGAGCAAGGTCTGAATCTGCACAGAGCAAGATGCTGAGTGGAGTCGGGGGCTTTGTGCTGGGCCTGCTCTTCCTTGGGGCCGGGCTGATCTACTTCAGGAGTCAGAAA
#GorillaDRB5_M77152  TTCTTGAAGCAGGATAAGTATGAGTGTTTCTTCAACGGGACGGAGTATAGAGACATCTATAACCAAGAGGAGGACTTGCGCTTCGACAGCGACGTGGGGGAGTACCGGGCGGTGACGCTGGGGCGGCCTGACGCCGAGTACTGGAACGACGAGCGGGCCTCGGTGGACACCTGCAGACACAACTACGGGGAGGTGCAGCGGCGAGAGCCTAAGGTGACTGTGCCTGCAAGGACCCAGACCCAGCACCTCCTGGTCTGCAATGGTTTCTATCCAGGCAGCATTGAAGTCAGGTGGTTCCGGAACGGCCAGGAAGAGAAGGCTGGGGTGGTGTCCACAGGCCTGATTCAGAATGGAGACTGGACCTTCCAGATTCTGGTGATGCTGGAAACAGTTCCTCAGAGTGGAGAGGTTTACACCTGCCAAGTGGACCACCCAAGCGTGACGATCCCTCTCACAGTGGAATGGAGAGCACAGTCTGAATCTGCACAGAGCAAGATGCTGAGTGGAGTCGGGGGCTTTGTGCTGGGCCTGCTCTTCCTTGGGGCCGGGCTGATCTACTTCAAGAATCAGAAA
#MacaDRB1_M60059     TTCTTGGAGTACTCTACATCTGAGTGTTTCTTCAACGGGACGGAGTTCAGATACTTCTATAACCAGGAGGAGTACGTGCGCTTCGACAGCGACGTGGGGGAGTACCGGGCGGTGTCGCTGGGGCGGCGTAGCGCCGAGTACTGGAACGACGCGCGGGCCGCGGTGGACACCTGCAGACACAACTACCGGGAGGTGCAGCGGCGACAACCTAAGGTGACTGTGCCTTCAAAGATCCAGCCCCAGCACCTCCTGGTCTGCAACGGTTTCTATCCAGGCAGCATTGAAGTCAGGTGGTTCCGGAATGGCCAGGAAGAGAAGGCTGGGGTGGTGTCCACAGGCCTGATCCACAATGGAGACTGGACCTTCCAGACCCTGGTGATGCTGGAAACAGTTCCTCAGAGTGGAGAGGTTTACACCTGCCAAGTGGAGCACCCAAGCGTGACCAGCCCTCTCACAATGGAATGGAGAGCACGGTCTGAATCTGCACAGAGCAAGATGCTGAGTGGAGTCGGGGGCATTGTGCTGGGCCTGCTCTTCCTTGGGGCCGGGCTGATCTACTTCAGGAATCAGAAA
#MacacaDRB3_M60060   TTCCTGGGGCATGCTAAGTCAGAGTGTTTCTTCAACGGGACGGAGTTCAGATACATCTATAACCAGGAGGAGTTGGTGCGCTTCGACAGCGACGTGGGGGAGTTCCGGGCGGTGACGCTGGGGCGGCCTGTCGCCGAGTCCTGGAACGACGAGCGGGCCCAGGTGGACACCTGCAGACACAACTACGGGGAGGTGCAGCGGCGACAACCTAAGGTGACTGTGCCTGCAAAGACCCAGCCCCAGCACCTCCTGGTCTGCAGTGGTTTCTATCCAGGCAGCATTGAAGTCAGGTGGTTCCGGAACGGCCAGGAAGAGAAGGCTGGGGTGGTGTCCACAGGCCTGATCCAGAATGGAGACTGGACCTTCCAGACCCTGGTGATGCTGGAAACAGTTCCTCAGAGTGGGGAGGTTTACACCTGCCAAGTGGAGCACCCAAGCGTGATGAGCCCTCTCACAGTGGAATGGAGAGCACGGTCTGAATCTGCACAGAGCAAGATGCTGAGTGGATTCGGGGGCTTTGTGCTGGGCCTGCTCTTCCTTGGGGCCGGGCTGATCTACTTCAGGAATCAGAAA
#MacacaDRB4_M60062   TTCTTAGAGTACTGTAAGTTTGAGTGTTTCTTCAATGGGACGGAGTACAGATACTTCTATAACCAAGAGGAGTACGTGCGCTACGACAGCGACGTCGGGGAGTACCGGGCGGTGACGCTGGGGCGGCCTGACGCCGAGTACTGGAACGACAGGCGGGCCGAGGTGGACACCTGCAGACACAACTACGGGGAGGTGCAGCGGCGACAACCTAAGGTGACTGTGCCTGCAAAGACCCAGCCCCAGCACCTCCTGGTCTGCAACGGTTTCTATCCAGGCAGCATTGAAGTCAGGTGGTTCCGGAACGGCCAGGAAGAGAAGGCTGGGGTGGTGTCCACAGGCCTGATCCAGAATGGAGACTGGACCTTCCAGACCCTGGTGATGCTGGAAACAGTTCCTCAGAGTGGAGAGGTTTACACCTGCCAAGTGGAGCACCCAAGCGTGACGAGCCCTCTCACAGTGGAATGGAGAGCACAGTCTGAATCTGCACAGAGCAAGATGCTGAGTGGAGTCGGGGGCTTTGTGCTGGGCCTGCTCTTCCTTGGGGCCGGGCTGATCTACTTCAGGAATCAGAAA
#TamaDRB_M76488      TTCTTGGAGCAGGCTAAGGCTGAGTGTCACTTCAACGGGACGGAGCTCAGATACTTCTACAACCAGGAGGAGTTGGTGCGCTTCGACAGCGACGTGGGGGAGTACCGGGCGGTGACGCTGGGGCGGCCTGACGAGGAGTACTGGAACGACACACGGGCCGCGGTGGACACCTGCAGACACAACTACGAGGAGGTGCCGCGGAGACAACCTAAGGTGACTGTGCCTGCAAAGACCCAGCCCCAGCACCTCCTGGTCTGCAGTGGTTTCTACCCAGGCAGCATTGAAGTCAAGTGGTTCCGGAACGATCAGGAGGAGAAGGCTGGGGTGGTGTCCACAGGCCTGATCCAGAATGGAGACTGGACCTTCCAGACACTGGTGATGCTGGAAACTGTTCCTCAGAGTGGAGAGGTTTACATCTGCCAAGTGGAGCACGCAAGCATGACGAGCCCTCTCACAGTGCAATGGAGAGCACGATCCGAATCTGCACAGAGTAAGATGCTGAGTGGAGTCGGGGGCTTTGTGCTGGGTCTGCTCTTCCTTGGAGCAGGGCTGATCTACTTCAGGAATCAGAAA
#H2EB_K01145         TTTTTGGAATACTGTAAATCTGAGTGTTTCTACAACGGGACGCAGCTTAGATACTTCTACAACCTGGAGGAGAACCTGCGCTTCGACAGCGACGTGGGCGAGTTCCGCGCGGTGACCCTGGGGCGGCCAGACGCCGAGAACTGGAACGAGAAGCGGGCCGAGGTGGACACGTGCAGACACAACTATGAGGATGTGCCGCGGAGAGAGCCTACGGTGACTGTGCCCACAAAGACGCAGCCCGAACACCTCCTGGTCTGCAGTGACTTCTACCCTGGCAACATTGAAGTCAGATGGTTCCGGAATGGCAAGGAGGAGAAAACAGGAATTGTGTCCACGGGCCTGGTCCGAAATGGAGACTGGACCTTCCAGACACTGGTGATGCTGGAGACGGTTCCTCAGAGTGGAGAGGTTTACACCTGCCAGGTGGAGCATCCCAGCCTGACCGACCCTGTCACGGTCGAGTGGAAAGCACAGTCCACATCTGCACAGAACAAGATGTTGAGTGGAGTTGGGGGCTTCGTGCTGGGCCTGCTCTTCCTGGGAGCGGGGCTGATCTACTTCAGGAATCAGAAA
#RatEB_M12382        TTTTTGGGATACCTTAAATTTGAGTGTTTCTACAACGGGACGCAGCTTAGATTAATCTACAACAGGGAGGAGTACGCGCGCTTCGACAGCGACGTGGGCGAGTACCGCGCGGTGACCCTGGGGCGGCCCTCAGCCGAGTACAGGAACGAGAGGCGGGCCGCGGTGGACACGTGCAGACACAACTACGAGGATGTGCCGCGGAGAGAACCCAAGGTGACCGTGCCTTCAAAGACGCAGCCCGAACACCTCCTGGTCTGCAGTGACTTCTACCCTGGCAGCATTGAAGTCAGATGGTTCCGGAATGGCAAGGAGGAAAAGGATGGACTCGTGTCCACCGGCCTGATCCGAAATGGAGATTGGACCTTCCAGTTGCTGGTGATGCTGGAGACGGTTCCTCAAGGTGGAGAGGTTTACACCTGCCAGGTGGAGCATCCAAGCCTGCCCAGCCCTGTCAGAGTGGAGTGGAAAGCACAGTCCACGTCTGCACAAAATAAGAAGATGAGTGGAGTCGGGGGCATCGTGCTGGGTCTGCTCTTCCTGGGAGCCGGGCTGGTCTACTTCAGGAGCCAGAAA
#PigDRB_M55165       TTCTTGCACCAGTTGAAATTCGAGTGTTTCTTCAATGGGACCGAGTTAAGGAATTGCTATAACGGAGAGGAGTACGTGCGCTTCGACAGCGACGTGGGCGAGTACCGGGCGGTGACCCTGGGGCGGCCAGACGCCAAGTACCGGAACGACAGGCGGGCGGCGGTGGACACGTGCAGACACAACTACAGGGATGTGCCGCGGCGAGAGCCCACAGTGACGGTGCCTGCAAAGACCCAGCCCCAGCACCTCCTGGTCTGCACTGGGTTCTACCCAGGCCACGTGGAGGTCAGGTGGTTCCGGAATGGCCAGGAAGAGGCGGCGGGGGTGGTCTCCACAGGCCTGATCCCTAATGGAGACTGGACCTTCCAGACCATGGTGATGCTTGAAACGGTTCCTCAGAGTGGAGAGGTCTACAGCTGCCGAGTGGAGCACCCCAGCCTGACGAGCCCCGTCACAGTGGAATGGAGGGCACGGTCTGAATCTGCTCAGGGCAAGATGATGAGTGGGGTCGGGGGCTTCGTCCTGGGTCTGCTCTTTGTTGCTGTGGGGCTGATCTACTTCAAGAATCAGAAA
#BotaDRB_U77067      TTCCTGGAGTATTATAAGGGCGAGTGTTTCTTCAACGGGACCGAGTTCAGACACTTCTATAATGGAGAAGAGTTCGTGCGCTTCGACAGCGACTGGGGCGAGTTCCGGGCGGTGACCCTGGGGCGGCCGGCCGCCGAGCACTGGAACGACAAGCGGGCCGAGGTGGACAGGTGCAGACACAACTACGGGGAGGTGCAGCGGCGAGAGCCTACAGTGACTGTGCCTGCAAAGACTCAGCCCCAGCACCTCCTGGTCTGCAACGGTTTCTACCCAGGCCACATTGAAGTCAGGTGGTTCCGGAACGGCCATGAAGAGGAGGCTGGGGTGATCTCCACAGGCCTGATCCAGAATGGAGACTGGACCTTCCAGACCATGGTGATGCTTGAAACAGTTCCTCAGAGTGGAGAGGTCTACACCTGCCAAGTGGATCACCCCAAGCGGACGAGCCCTATCACAGTAGAATGGAGGGCACGGTCTGACTCTGCTCAGAGCAAGATGATGAGTGGAGTCGGGGGCTTCGTTCTGGGTCTGCTCTTCCTTGCCGTGGGGCTCATCTACTTCAGGAATCAGAAA
#SheepDRB_M93432     TTCCTGGAGTATACTAAGAAAGAGTGTTTCTTCAACGGGACGGAGTTGAGATACTTCTATAATGGAGAAGAGTACGTGCGCTTCGACAGCGACTGGGGCGAGTTCCGGGCGGTGGCCCTGGGGCGGCCGGACGCCAAGTACTGGAACGATAGGAGGACCGCGGTGGACACGTGCAGACACAACTACGGGGAGGTGCAGCGGCGAGAGCCTATAGTGACTGTGCCTGCAAAGACCCAGCCCCAGCACCTCCTGGTCTGCAATGGATTCTACCCAGGCCACATTGAAGTCAGGTGGTTCCGGAACGGCCACGAAGAGGAGGCTGGGGTGATCTCCACAGGCCTGATCCAGAATGGAGACTGGACCTTCCAGACCATGGTGATGCTTGAAACAGTTCCTCAGAGTGGAGAGGTCTACACCTGCCAAGTGGATCACCCCAGCCGGACGAGCCCTATCACAGTGGAATGGAGGGCACGGTCTGACTCAGCTCAGAGCAAGATGATGAGTGGAGTTGGGGGCTTTGTTCTGGGTCTGCTCTTCCTTGCGGTGGGGCTCATCTACTTCAGGAATCAGAAA
#DogDRB_M29611       TTCTTGGAGGTGGCAAAGTCCGAGTGCTTCACCAACGGGACGGAGTTCAGATACATCCATAACCGGGAGGAGTTCGTGCGCTTCGACAGCGACGTGGGGGAGTTCCGGGCGGTCACGCTCGGGCGGCCCGTCGCTGAGTCCTGGAACGAGGAGCGGGCAACGGTGGACACCTGCAGACACAACTACGGGGAGGTGCAGCGGCGAGAGCCTACAGTGACTGTGCCTACGAAGACTCAGACCCAGCATCTCCTGGTCTGCAATGGTTTCTATCCAGGCCACATTGAAGTCAGGTGGCTCCGGAATGGCCAGGAAGAGGAAGCTGGGGTTGTGTCCACAGGCCTAATCCGTAATGGAGACTGGACCTTCCAGATCCTGGTGATGCTGGAGATAGTTCCTCAGAGCGGAGAGGTCTACACCTGCCAAGTGGAGCACCCAAGTTTGACAAGCCCTGTCACCGTGGAATGGAGGGCACAGTCTGATTCTGCACAGAGCAAGATGCTGAGTGGAATCGGGGGCTTTGTCCTGGGTCTGCTCTTCCTTGCAGTGGGGCTGATCTACTTCAGAAATCAGAAG
#HLADQB_M20432       TTCGTGTTCCAGTTTAAGGGCATGTGCTTCACCAACGGGACGGAGCTTAGATACATCTATAACCGAGAGGAGTACGCGCGCTTCGACAGCGACGTGGGGGTGTACCGCGCGGTGACGCAGGGGCGGCCTGATGCCGAGTACTGGAACGAAACCCGGGCGGAGTTGGACACGTGCAGACACAACTACGAGGCGTTGCAGAGGAGAGAGCCCACAGTGACCATCCCATCCAGGACAGAGGCCAACCACCTGCTGGTCTGCACAGATTTCTATCCAGGCCAGATCAAAGTCCGGTGGTTTCGGAATGATCAGGAGGAGACAGCCGGCGTTGTGTCCACCCCCCTTATTAGGAATGGTGACTGGACTTTCCAGATCCTGGTGATGCTGGAAATGACTCCCCAGCGTGGAGATGTCTACACCTGCCACGTGGAGCACCCCAGCCTCCAGAGCCCCATCACCGTGGAGTGGCGGGCTCAGTCTGAATCTGCCCAGAGCAAGATGCTGAGTGGCGTTGGAGGCTTCGTGCTGGGGCTGATCTTCCTTGGGCTGGGCCTTATCCGTCAAAGGAGTCAGAAA
#BolaDQB_M30003      TTCGTGGTCCAGTTTATGGGCCAGTGTTTCACCAACGGGACGGAGTACAGATACATCTACAACCAGGAGGAGTACGCGCGCTTCGACAGCGACTGGGGCGAGTACCGGGCGCTGACCCGCTGGCGGCCGGCCGCCGAGTACTGGAACGACACGTGGGCCGAGGTGGACAGGTGCAGAAACAACTACCAGGAATGGCAGCGGCAAGAACCTACAGTGACCATCCCGTCCAGGACAGAGGCTAACCACCTGCTGGTCTGCACGGATTTCTATCCGGGCCAGATCAAGGTTCGGTGGTTCCGGAATGACCGGGAGGAGACAGCCGGCGTTGTGTCCACCCCTCTTATAGGGAATGGGGACTGGACCTTCCAGATCCTCGTGATGCTGGAAATGACCCCCCAGCGAGGAGATGTCTACACCTGCCGCGTGGAGCACCCCAGCCTCCAGAGCCCCATCATGGTGGAGTGGCGGGCACAGTCTGAATCTGCCCAGAGCAAGATGCTGAGTGGTGTTGGGGGCTTCGTGCTGGGGCTGATCTTCCTCGGGCTGGGCCTCATCCGTCACAGGAGCCAGAAG
#SheepDQB_L08792     TTCGTGCACCAGTTTAAGGGCCTGTGTTTCACCAACGGGACGGAGCTCAGATACATCTACAACCGGGAGGAGTACGCGCGCTTCGACAGCGACTGGGGCGAGTACCGGGCGGTGACGCTGGGGCGGCGGCAAGCCGAGTACTGGAACGACGTGCGGGCCGAGGTGGACACGTGCAGACACAACTACCAGGAGTTGCAGCGGCGAGAACCTACAGTGACCATCCCAACCAGGACTGAGGCTAACCACCTGCTGGTCTGCACAGATTTCTATCCAGGCCGGATCAAGGTTCGGTGGTTCCGGAATGACCAGGAGGAGACAGCCGGAGTTGTGTCCACACCTCTTATTAGGAACGGGGACTGGACCTTCCAGATCCTCGTGATGCTGGAGATGACCCCCCAGCGAGGAGATGTGTACACCTGCCGCGTGGAGCACCCCAGCCTCCAGAGCCCCATCATGGTGGAGTGGCGGGCACAGTCTGAATCTGCCCAGAGCAAGATGCTGAGTGGTGTTGGGGGCTTCGTGCTGGGGCTGATCTTCCTCGGGCTGGGCCTCATCCGTCACAGGAGCCAGAAG
#HorseDQB_L33910     TTCGTGTACCAGTTTAAGGGCCAGTGCTTCACCAACGGGACGGAGCTCAGATACATCTACAACCGGGAGGAGTACGTGCGCTTCGACAGCGACGTGGGGGAGTACCGGGCGCTGACCCTGGGGCGGCCGACCGCCGAGTACTGGAACGACACGCGGGCCGAGTTGGACAGATGCAGATACAACTACCAGGAGTTGCAGCACCAAGAACCTACAGTGACCATCCCATCCAAGACAGAGGTTAACCACCTGCTGGTCTGCACAGATTTCTATCCAAGCCAGATCAAAGTTCGGTGGTTCCGGAATGACCAGGAGGAGACAGCTGGCGTTGTGTCCACCCCCCTTATTAGAAACGGGGACTGGACCTTCCAGATCCTTGTGATGCTGGAAATGACTCCCCAGCGAGGAGATGTCTACACCTGCCACGTGGAGCACCCCAGCCTCCAGAGCCCCATCACAGTGCAGTGGCGAGCACAGTCTGAATCTTCCCAGAGCAAGATGCTGAGTGGCGTCGGGGGCTTCGTGCTGGGGCTCATCTTCCTCGGACTGGGCCTTATCCGTCACAGGAGCAAGAAG
#H2AB1_M13538        TTCGTGCACCAGTTCCAGCCCTTCTGCTTCACCAACGGGACGCAGCTTAGATACATCTACAACCGGGAGGAGTACGTGCGCTTCGACAGCGACGTGGGCGAGTACCGCGCGGTGACCCTGGGGCGGCCAGACGCCGAGTACTGGAATCAGACGCGGGCCGAGCTGGACACGTGCAGACACAACTACGAGGAGCTGCGGCGGCTTCAGCCCAGTGTCGTCATCCTGTCCAGGACAGAGGCCAACCACACGCTGGTCTGCACAGATTTCTACCCAGCCAAGATCAAAGTGCGCTGGTTCCGGAATGGCCAGGAGGAGACGGTGGGGGTCTCGTCCACACAGCTTATTAGGAATGGGGACTGGACCTTCCAGGTCCTGGTCATGCTGGAGATGACCCCTCGGCGGGGAGAGGTCTACACCTGCCATGTGGAGCATCCCAGCCTGAAGAGTCCCATCACCGTGGAGTGGCGGGCACAGTCCGAGTCTGCCCGGAGCAAGATGTTGAGCGGCATCGGTGGCTGCGTGCTTGGGGTGATCTTCCTCGGGCTTGGCCTTATCCGTCACAGGAGTCAGAAA
#RATB1B_X56596       TTCGTGTACCAGTTCAAGGGCCTGTGCTACACCAACGGGACGCAGGATAGATACATCTACAACCAGGAGGAGTACCTGCGCTACGACAGCGACGTGGGCGAGTACCGCGCGCTGACCCTGGGGCGGCCCTCAGCCGAGTACTTTAACCAGACGCGGGCCGAGCTGGACACGTGCAGACACAACTACGAGGAGCTGCGGCGGCTTCAGCCCAATGTGGCCATCCTGTCCAGGACAGAGGCCAACCACTTGCTGGTCTGCACAGATTTCTACCCAGCCCAGATCAAAGTGCGCTGGTTCCGGAATGGCCAGGAGGAGACGGCGGGGGTCGTGTCCACACAGCTTATTAGGAACGGGGACTGGACCTTCCAGATCCTGGTCATGCTGGAGATGACGCCTCAGCGGGGAGAGGTGTACATCTGCCATGTTGACCACCCCAGCCTTGAGAGCCCCGTCACAGTGGAGTGGCGGGCACAGTCCGAGTCTGCCCAGAGCAAGATGCTGAGCGGCATCGGGGGCTTTGTGCTGGGGGTGATCTTCCTCGGGCTTGGCCTTATCCGTCACAAGCGTCAGAAA
#HLADPB_M57466       TACGTGCACCAGTTACGGCAGGAATGCGGCTTTAATGGGACACAGTTCAGTTACATCTACAACCGGGAGGAGTTCGTGCGCTTCGACAGCGACGTGGGGGAGTTCCGGGCGGTGACGCTGGGGCGGCCTGATGAGGACTACTGGAACGACGAGCGGGCAGTGCCGGACAGGTGCAGACGCAACTACGAGGAGCTGCAGCGCCGACAGCCTAAGGTGAACGTTCCCTCCAAGAAGGGGCCCCAGCACCTGCTTGTCTGCACAGATTTCTACCCAAGCAGCATTCAAGTCCGATGGTTCCTGAATGGACAGGAGGAAACAGCTGGGGTCGTGTCCACCAACCTGATCCGTAATGGAGACTGGACCTTCCAGATCCTGGTGATGCTGGAAATGACCCCCCAGCAGGGAGACGTCTACATCTGCCAAGTGGAGCACACCAGCCTGGACAGTCCTGTCACCGTGGAGTGGAAGGCACAGTCTGATTCTGCCCAGAGTAAGACATTGACGGGAGCTGGGGGCTTCGTGCTGGGGCTCATCATCTGTGGAGTGGGCATCATGCACAGGAGGAGCAAGAAA
#RabbitDPB_M21468    TACCTGTGGCAGAGACGATACGAATGCGCCTCCAACGGGACGCAGTTGAGATGCGCCTACAACAGGGAGGAGTTCGTGCGCTTCGACAGCGACATCGGGGAGTTCCGCGCCGTCAGCCTCGGCCGGCAGGTCGCCGAGTCCTGGAACGAAGCGCGGGCCGAGGTGGACAGGTGCAGACACAACTACGAGCAGGTGCTGCTCCAACAGCCCCGAGTGAGCGTCCCCTCCAAGAAGGGGCCCCAGCACTTGCTCGTCTGCACAGATTTCTATCCAGGCCACGTTCAAGTCCGTTGGTTCCTGAATGGACGGGAGGAAACAGCCGGGGTCGTGTCCACCCACCCGATCCATAATGGAGACTGGACCTTCCAGATCCTGGTGATGCTGGAAATGACCCCCCACCAGGGAGACGTCTACACCTGCCACGTGGAGCACCCCAGCCTGGACAGTCCCATCACTGTGGAGTGGAAGGCACAGTCTGATTCCGCCCGGAGCAAGATGCTCGCTGGCGTCGGGGGGTTAGTGCTGGGGCTCGTCTCGCTGGCAGTGGGCGTCATGCACAGGAGGAGCAAGAAA
#MRatDPB_M16685      TACCTGTTCCGAGCGTGGCAGGAATGCCTCACCCACGGAAGGTACTACAGATACATCTACAACCAAGAGGAGTACGTGCGCTTCGACAGCGACGTGGGCGTGTTCCGCGCGGTGACCCTGGGGCGGTCGTGGGCCGACGACTTCAACGAGAAGCGCGCCGCGCCCGACACGTGCAGACACAACCACGAGCAGCAGTCGCTCATACAGCCTAAGGTACACGTGCCCTCCAAAGGAGGGACCAACCATCTGCTCGTCTGCACAGATTTCTACCCAGGCAACATCCAAGTCCGCTGGTTCCGGAACAACCAGGAGGAAACAACTGGGATCTCAACCACCAACCCGATCCGCAATGGAGACTGGACCTTCCAGATCCTGGTGACACTGGAAATGACCCCTCAGCGGGGAGACGTCTACACCTGCCACGTGGAGCACCCCAGCCTGGACAGACCCATCACCGTGGAGTGGAGGGCCCAGTCTGACTCTGCCCGGAACAAGACACTGACTGGAGTTGGGGGCCTGGTGCTGGGGCTCATCTTCCTGGCAGTGGGCCTCATGCACGTGAGGAGCAAGAAA
#HLADOB_L29472       TTTGTGATTCAGGCAAAGGCTGACTGTTTCACCAACGGGACAGAATTTAGATTCATCTTTAACTTGGAGGAGTATGTACGTTTCGACAGTGATGTGGGGATGTTTGTGGCATTGACCCTGGGGCAGCCAGATGCTGAGCAGTGGAACGATAGCAGACAGGCCGTGGATGGGTGTAGACACAACTACAGGGCAGTGGGGAGAAAACAACCAGAGGTGACAGTGCCAGAGAGGACCCCACTCCACCAGCTGCTGCACTGCACAGGCTTCTATCCAGGGGATATCAAGATCAAGTGGTTCCTGAATGGGCAGGAGGAGAGAGCTGGGGTCATGTCCACTGGCCCTATCAGGAATGGAGACTGGACCTTTCAGACTGTGGTGATGCTAGAAATGACTCCTGAACTTGGACATGTCTACACCTGCCTTGTCGATCACTCCAGCCTGCTGAGCCCTGTTTCTGTGGAGTGGAGAGCTCAGTCTGAATATTCTTGGAGAAAGATGCTGAGTGGCATTGCAGCCTTCCTACTTGGGCTAATCTTCCTTCTGGTGGGAATCATCCAGCTAAGGGCTCAGAAA
#ChimpDOB_M24358     TTTGTGATTCAGGCAAAGGCTGACTGTTTCACCAACGGGACAGAATTTAGATTCATCTTTAACTTGGAGGAGTATGTACGTTTCGACAGTGATGTGGGGATGTTTGTGGCATTGACCCTGGGGCAGCCAGATGCTGAGCAGTGGAACGATAGCAGACAGGCCGTGGATGGGTGTAGACACAACTACAGGGCAGTGGGGAGAAAACAACCAGAGGTGACAGTGCCAGAGAGGACCCCACTCCACCAGCTGCTGCACTGCACAGGCTTCTATCCAGGGGATATCAAGATCAGGTGGTTCCTGAATGGGCAGGAGGAGAGAGCTCGGGTCATGTCCACCGGCCCTATCAGGAATGGAGACTGGACCTTTCAGACTGTGGTGATGCTAGAAATGACTCCTGAACTTGGACATGTCTACACCTGCCTTGTCGATCACTCCAGCCTGCTGAGCCCTGTTTCTGTGGAGTGGAGAGCTCAGTCTGAATATTCTTGGAAAAAGATGCTGAGTGGCATTGCAGCCTTCCTACTTGGGCTAATCTTCCTTCTGGTGGGAATCATCCAGCTAAGGGCTCAGAAA
#H2OB_M19423         TTTGTGATTCAGGCAAAGGCGGACTGTTTCACCAATGGTACAGAATTGAGGTTCATCTTCAACCTGGAGGAGTATTTACACTTCGACAGTGACCTGGGGATGTTTGTGGCTCTGACGCTGGGGGAACCTGATGCTGACCAGTGGAACGATAGCAGAGCTGCTGTGAACATGTGCAGGCAGAAGTACAAGGCCGTGGAGAGAAATCCTCCAGAGGTGACAGTGCCAGAGAGGACCCCGTTGCAGCAGCTGCTGCTCTGCACAGGCTTCTACCCCGGGGACATAAGTGTCAAGTGGTTCCGGAATGGACAGGAGGAGAGGTCTGGGGTCATGTCCACTGGCCTTGTTAGGAATGGAGACTGGACCTTCCAGACAACAGTAATGCTGGAAATGATCCCAGAGCTTGGTGACATCTACAGCTGCCTCGTGGAGCACCCCGGCCTCCTGAGACCTGTTTCTGTGGCATGGATGGCTCAGTCTGAATATTCCTGGAAAAAGATACTGAGTGGAGCTGCAGTGTTCCTGCTTGGGCTGATTGTCTTCCTGGTGGGGGTTATCCATCTCAAGGCTCAGAAA
#RabbitDOB_M96942    TTTGTGATTCAGGCAAAGGCTGACTGCTTCACCAACGGGACAGAGGTTAGGTTTATCTTTAATTTGGAGGAGTATGCACACTTTGACAGCGACGTGGGGATGTTTGTGGCACTGACGCTGGGGCAGCCTGATGCTGAGTCGTGGAACGACAGCAGACGGTCTGTGGATTTTTGTAGACGCAACTACAGGGCTGTGGGGAGAAAACCACCAGAGGGTACAGTGCCAGAGAGGACCCCGGTCCAGCAAGCTCTGCTCTGCGACGGGCTTCTATCGGGGGACATCAGAGTCAGGTGGCTGCGGAATGGGCAGGAGGAGAGAGCTGGGATCATGTCCACTGGCCTTATCAGAAACGGAGACTGGACCTTTCAGACCACGGAGATGCTGGAAATGACTCCTGAGCTTGGAGACGTCTACACTTGTCTCGTGGATCACCCCAGCCTGCTGAGCCCCGTTTCTGTGGAGTACGCGAGGCCTCAGTCTAATATCTGGGCAAAGATGCTAAGTGGAGTTGCAGGCTTCCTGTTTGGGCTGATCTTCCTTCTGGTGGGAACCATTCATATCAGGGCTTGGAAG
#MarspDAB_M81624     TTCCTGTGGCAGGCAAAGTCCGAGTGTTTTGAGAACGGGACGCAGTTTAGATACTTCTACAACCGGCAGGAGGCTTTGCGCTTCGACAGCGACGTGGGGGAGTACGTGGCGGTGTCGCTGGGGCGGCTACAGGCTGAGCTTTGGAACGAGGCTCGGGCCGCGGTGGACACTTGCAGGCACAACTACGAGGAGGTCCCCAGGCGTGAGCCCGAGGTGACTGTGCCATCAAAGCTGGCTCCCGGACACCTGCTTGTGTGCACTGGTTTCTATCCTGGGGATGTTGAGGTCAGGTGGTTCCTGAATGGGCAGGAGGAGACAGCTGGTGTTGTGTCCACAGGCCTGGTCAGCAATGGAGACTGGACTTACCAGATGTTGGTGATGCTGGAAATGACTCCCAAGCATGGTGATGTCTACACATGCCAAGTGGAGCATTCCAGCCTTCAGAAACCTGTCATCTTGGACTGGAAAGCACAGTCTGAATCTGCCCAGAGTAAGATGCTGAGTGGAGTCGGGGGCCTTGTGCTGGGGCTGATCTTCTTTGGGGTTGGCCTCGTCTACAAGAGGAATCAGAAA
#MarspDBB_M81625     TTCGTGTATCAGTACAAGGCTGAGTGTTTCACCAACGGCTCGGAGTTTAGAGACATCTACAATGGCGAGGAATTTGCCCGCTTCGACAGCGACGTGGGAGTGTACGTGCCCGTGACGCTGGGGCGGCCCGATGCTGAGTACTGGAACGAGGAACGAGCCTACGTGGACACGTGCAGACACAACTACGAGGCTTTGGACAGAAGACAGCCCAGAGTGACCATCCCCTCCAAGACAGACGCCCAGCACCTGCTGGTCTGCACTGGCTTCTATCCAAGCAAGATCAAGGTCACCTGGTTCAAGAATGGGCAGGAGGAGACAGCTGGGATCGTGTCCACGGGTGTGATACAACATGGAGACTGGACCTACCAGACCCTGGTCATGTTGGAAATGACTCCCCAGAGCAGAGATGTCTACACCTGCAGTGTGGAGCATGCCAGCCTACAGAGCCCCATCAGTGTGGAATGGAGGGCACAGTCTGAATCTGCCCAGAGCAAATTGCTGAGTGGAATTGGAGGCTTTGTCCTGGGGCTGATCTTCCTCAGTGTAGGGCTGATCCACCTGAAGAACAAGAAA
#GagaBLBII_M29763    TTCTTCTGCGGTGCGATATCCGAGTGCTACCTGAACGGCACCGAGTATAGGTACATCTACAACCGGCAGCAGTTCACGCACTTCGACAGCGACGTGGGGAAATTTGTGGCCGATTCACTGGGTGAGCCGCAAGCTGAATACTGGAACGAGCGAATGAATGAAGTGGACAGGTGCCGGCACAACTACGGGGAGGTGCAGAGGAGCGAGCCCAAGGTGAGGGTCGCGCTGCAGTCGGGCTCCCCCGAACGTCTGGCGTGCACGGGCTTCTACCCGCCGGAGATCGAGGTGAAGTGGTTCCTGAACGGGCGGGAGGAGACGGAGCGCGTGGTGTCCACGGACGTGATGCAGAACGGGGACTGGACGTACCAGGTGCTGGTGGTGCTGGAGACCGTCCCGCGGCGCGGGGACAGCTACGTGTGCCGGGTGGAGCACGCCAGCCTGCGGCAGCCCATCAGCCAGGCGTGGGAGCCGCCGGCGGACGCGGGCAGGAGCAAGCTGCTGACGGGCGTGGGGGGCTTCGTGCTGGGGCTCGTCTTCCTGGCGCTGGGGCTCGTGTTCCTGCGCGGTCAGAAA
#ChickenB_M26306     TTCCAGTGGACTTTTAAAGCAGAGTGCTACCTGAACGGCACCGAGTTTAGGCACATCTACAACCGGCAGCAGTTCATGCACTTCGACAGCGACGTGGGGAAATACGTGGCCGATACACTGGGTGAGCGTCAGGCTGAAATCTGGAACGAGGAAATGAATGCAGTGGATACGTGCCGGCACAACTACGGGGAGGTGCAGAGGAGCGAGCCCAAGGTGAGGGTCGCGCTGCAGTCGGGCTCCCCCGAACGTCTGGCGTGCACGGGCTTCTACCCGCCGGAGATCGAGGTGAAGTGGTTCCTGAACGGGCGGGAGGAGACGGAGCGCGTGGTGTCCACGGACGTGATGCAGAACGGGGACTGGACGTACCAGGTGCTGGTGGTGCTGGAGACCGTCCCGCGGCGCGGGGACAGCTACGTGTGCCGGGTGGAGCACGCCAGCCTGCGGCAGCCCATCAGCCAGGCGTGGGAGCCTCCGGCGGACGCGGGCAGGAGCAAGCTGCTGACGGGCGTGGGGGGCTTCGTGCTGGGGCTCGTCTTCCTGGCGCTGGGGCTCGTGTTCCTGCGCGGTCAGAAA
#ChickenB_M26307     TTCTTCTACGGTGCGATAGGTGAGTGCTACCTGAACGGCACCGAGTATCGGGAAATCTACAACCGGCAGCAGTACGCGCACTTCGACAGCGACGTGGGGAAATTTGTGGCCGATACACTGGGTGAGCCGCAAGCTGAATACTGGAACGAGCTAATGAATATAGCGGACGGGTGCCGGCACAACTACGGGGAGGTGCAGAGGAGCGAGCCCAAGGTGAGGGTCGCGCTGCAGTCGGGCTCCCCCGAACGTCTGGCGTGCACGGGCTTCTACCCGCCGGAGATCGAGGTGAAGTGGTTCCTGAACGGGCGGGAGGAGACGGAGCGCGTGGTGTCCACGGACGTGATGCAGAACGGGGACTGGACGTACCAGGTGCTGGTGGTGCTGGAGACCGTCCCGCGGCGCGGGGACAGCTACGTGTGCCGGGTGGAGCACGCCAGCCTGCGGCAGCCCATCAGCCAGGCGTGGGAGACTCCGGCGGACGCGGGCAGGAGCAAGCTGCTGACGGGCGTGGGGGGCTTCGTGCTGGGGCTCGTCTTCCTGGCGCTGGGGCTCGTGTTCCTGCGCGGTCAGAAA
#ChickenB_X07447     TTCCAGTGGAGTGCTACAGTTGAGTGCTTCCTCAACGGCACCGAGTTTAGGCACGTCTACAACCGGCAGCAGTACGTGCACTTCGACAGCGATGTTGGTCTCTTTGTGGCCGATACACTGGGAGAGCCTTCTGCTAAACTCTTCAACGACAACAGGGCTGCAGTGGAAATGTGCAACTACAACTACGAGGCCCTGCAGAGGAGAGAGCCCAAGGTGAGGATCGCGCTGCAGTCGGGCTCCCCCCAACGGCTGGCTTGCACGGGCTTCTACCCGCCGGAGATCGAGGTGAAGTGGTTCCAGAACGGGCAGGAGGAGACAGAGCGCGTGGTGTCCACGGACGTGATCCAGAACGGGGATTGGACGTACCAGGTGCTGGTGGTGCTGGAGATCAGCCCACGGCACGGGGACAGCTATGTGTGCCAGGTGGAGCACACCAGCCTGCAGCAGCCCATCACCCAGCGCTGGGAGCCCCCGGGGGATGTGAGCAGGAGCAAGCTGCTGATGGGCGTCGGGGGCTTTGTGCTGGGGCTCGTCTACCTTGCACTGGGGATCTTCTTCCTGTGCAGTAAGAAA
#FrogB_D13684        TACGTGTTTCAGTGGAAGAGTCAGTGTTACAGGAACGGCACCGACTATGGCTACGCTAATAATCAGGAGGAGTACGCCTACTTTGACAGTGATGTGGGGGAATATAAAGCTAAAAACTTTGGAGAAGTGCAGGCGAAGTATTGGAACGATAAACGGGCTGTGGTGGATACATGCAGATACAACTATCAGAAAGTAGACAGGAAACAACCCGATGTGAAGATTAACACGAAGACACTGGATGAACATCTGATAACCTGCGATGGGTTCTTTCCTCCAATGATAAAGGTGACTTGGCTGAAGAATGGGATTGAAGAGAGAGAACAAGTCACATCCTCAGCATTACTAAAGAATGGAGACTGGACATTTGAAATCCATGTGATGCTGGAGACAACCATTAAACATGGTGACACTTTCACCTGCCAAGTGGAGCACAGCAGCCTTCAACAACCTGTATCTGTGAACTGGGAACCAGATTCTGAATCTGCTCGCAATAAGATGTTGACTGGTATTGTGGGCTTTGTGCTGGGATCCATCTTCATCATAGTTGGCCTTGTTTACCTACGGAGTAAGAAG
#FrogB_D13685        TTCGTGTATCAGTCGAAGGGTCAGTGTTACAGGAACGGCACCGACCTTCGCTACATTAGTAATCAGGAGGAGTTCGTCTACTTTGACAGTGAAGTGGGTTTCTTTATCGCTAAAAACTGGGGGAAACCGGATGCGGATAATTGGAACGAGTACCGGGCTGAGGTGGATACATGCAGACACAACTATCAGAAAGTAGACAGGAAACAACCCAATGTGAAGATTAACACAAAGACGCTGGATGAACATCTGATAACCTGCGATGGGTTCTTTCCTCCTATGATAAAGGTGACTTGGCTGAAGAATGGGATTGAAGAGGGAGAACAGGTCACATCCTCAGAGTTACTACCGAATGGAGACTGGACATTTGAAATCCATGTGATGCTGGAGACAACCATTAAACATGGTGACACTTTCACCTGCCAGGTGGAGCACAGCAGCCTTCAACAACCTGTATCTGTGAACTGGGAGCCAGATTCTGATTCTGCTCGCAATAAGATGCTGACTGGTATTGTTGGGTTTGTGCTTGGATCCATTTTCATCATTGTCGGCCTTGTTTACCTCCGGAGTAAAAAG
#FrogB_D13688        TTCGTGTATCAGTTCAAGGGTCAGTGTTACAGGAACGGCACCGACCTTCGCCACTACTATAACCTGGAAGAAACCGATTACTTTGACAGTGATGTGGGTTTGTTTATCGCTAAAACCCTGGGGAAACCGGATGCGGATAATTGGAACGATACACGGGCTGCGGTGGACACATGCAGACACAACTATCAGAAAATAGACAGGAAACAACCCAATGTGAAGATTAACACAAAGACATTGGATGAACATCTGATAACCTGCGATGGGTTCTTTCCTCCTATGATAAAGGTGACTTGGCTGAAGAATGGGATTGAAGAAGGAGAACAGGTCACGTCCTCAGAGTTACTACAGAATGGAGACTGGACATTTGAAATCCATGTGATGCTGGAGACAACCATTAAACATGGCGACACTTTCACCTGCCGGGTGGAGCACAGCAGCCTTCAGCAACCTGTATCTGTGAACTGGGAGCCAGATTCTGAATCTGCTCGCAATAAGATGTTGACTGGTATTGTTGGGTTTGTGCTTGGATCCATCTTCATCATAGTTGGCCTCGTCTACCTCCGGAGTAAGAAG
#BrreDAB1_L04805     TATTATCAGTATACAATGTTAGAATGCATCTACAGCACCAGTGATTTGTCAGGTTCTTTCAATAAAGTTGTGGATGTTCAGTACAACAGCACTGTGGGGAAGTATGTAGGGTACACTCAGGGAGTGATTTTTGCACGAAACTTCAACGCACGGAAAGCTGAGGTGGAAAGTTGCAGACATAATGCTCAGTCGCGTGATAAAGCAAAACCGAAGGTAACAATTTCAGTGATGCAGGCTGAAAAACATATGCTGCTGTGCTATGAGTTCTACCCTAAAAAAATTAAAATGTCTTGGCTGAGAGATGATAAAGTGGTGACCTCAGATGTGACCTCCACTATAGAGATGGCTAATGGTAACTGGTACTATCAGATTCACTCTCACCTTGAATACACTCCCAAATCTGGAGAGAAGATCCAATGTGTGGTGGAGCACGCCAGCTCAACTCAACCTATTACTAAAGAATGGAATCCTCATTCTGAGTCCGACAGGAATAAATTTGCCATAGGAGCCTCTGGTCTGGTGCTGGGAATTATTATAGCGATTGCTGGACTCATTTACTACAAGAAGAAATCA
#BrreDAB4_U08870     TATTACGACTATATCAAGCAGCAATGCTTCTACAGCACCAGTGATTATTCATATTCCTTCAATAAAGTTGTGGATACTCAGTTCAACAGCTCTGTGGGGAAGTTTGTGGGGTACACTCAGGGACTGATATTTGCAGAGAACTTCAACGCCTTGAAAGCTCAAGTGGACACATGCAGACATAATGCTCAGTGGCGTGATAAAGCACTACCAGAGGTAACAATCTCAGTGAGGCAGGCTGAAAGACATGTGTTGCTGTGCTATGAATTCTACCCTAAAAAAATCAAAATGTCCTGGCTGAGAGATGGTAAAGAGGTGACCTCAGATGTGACCTCCACTATGGAGATGGCTGATGGAGACTGGTACTATCAGATTCATTCTCACCTGGAATACACCCCTAAATCTGGAGAGAAGATCCAATGTTTGGTGGAGCACGCCAGCTTAACTCAACCTCTTACTAAAGATTGGAATCCCCATTCTGAGTCTGACAGGAATAAATTTGCCATCGGAGCATCTGGTCTGGTGCTGGGAATCATCATAGCGATTGCTGGACTCGTTTACTACAAGAAGAAATCA
#BrreDCB_U08873      AATTACGGCTATCTTCAAAGTCAATGTGTACTGAGCTCTACAAAGTTCTCATTCATCTTCAACAAGATTGAATACATTAGATACAACAGTACTGATCAGAAAATTGTTGGCTACACTTTTGGAGAGAAATTTGTTGAAAACTATAAATTTGTCCTGGCTGAGTTTGGGATTTGCAAAAAAATTGCAAAGTCTAATCATGTGACAAAACCAGAAGTCATTATTTCAGTTACTGAAGCTAAAAATCAGGTCCTGGTGTGCTATGACTTTTACCCCAAAGCCATTAAACTGACGTGGATGAGGAATGATAAAAGGGTTACAGCTGATGTGACGTCCATTGAGGAGATGGCTGATGGAGACTGGTATTATCAGATTCACTCCCACCTGGAATATTTTCCTCAACCTGGAGAGAAGATCTCCTGTGTGGTGGATCATGCCAGCTTCCATAAACCCATGATCTATTACTGGGATCCCTCTCCCGAGACTGAAAGATCTAAGATCATTCTTGGGGCTGTGGGGCTGCTGATGGGGATCTTTACAGCAGCTGCAGGAGTGATCTATTATAAAAGAAATCAA
#BrreDEB_U08874      TATTATCACAGTAGGCTTACAAAATGCATCTTCCAGCTCCAGGATGTTAATTATATCTTCAATAAAGATGTGTACATACGATTCAACAGCACTTTGGGGTACTTTGTTGGGTACACTCATGGAGTATATAATGCACAATTATGGAAGCAGGAGAGAGCTCACGAGGATCGATGCAAATACAATGCTGAGGACCTAGGAAAAACAAAACCACAGGTTAAGCTTTCAGTGAAGCAGGCTGGTAGACAGGTGTTGGTGTGCTATGACTTCTATCCCAAAAGAATCAAAGTCACCTGGTTAAGAAATGGTAAACCAGTGACCACTGATGTAACCTCCACTGAGGAGCTGGCTGATGGGGACTGGTACTACCAAATTCATTCCCACCTGGAATACACCCCCAAATCTGGAGAAAAGATTTCCTGTATGGTGGATCATGCCAGCTCAACTGAACCCATCATCATAGCCTGGGATTCATCTTCTGAGCCTGAGAGGAATAAAATTGCTATTGGAGCATCTGGTTTGGTGCTGGGAATCATCATTGCCACTGCTGGACTCATTTATTACAAGAAGAAATCA
#SharkB_L20274       CATTCCGAGATTAGCTTGCATAGATGTTTTAACAGCACCGGGGACTTTCAGCAAGTTTATGACCAGGAGCTGATCGCGTATTATGACTATAACCAGAGGAAGTTCATCGCGGTGAAATGGATGAAGTCTAATGTGGACAGATGGAACGCGCAGTACGAGAGCGGGAAGGCTTGTGAACACAACATCCCGGAGCTGGCCCGGCAAGAACCAAAGGTGACAATCCGAACAAAAGAATCGACAGGGCCCATACTCATTTGTGTTGGATTTTACCCAGCAAAGATCAGTGTCACGTGGCTGAAAAATGGACAGAAGGTTTCTGATGCTGATGTCACAGTTGAGTTGTTATCAAATGGTGACTGGACATATCAGGTTCGCCAGTATCTCCAGTATGAGCCAGTGTATGGTGATAAATACACCTGCCATGTGGAACACAGCAGCCTGACCTCACCAATGAGTGTGGATTGGGAAGTAGAGAGTAAATCTGAAAAAACAAAGATCATTGTCGGAGTGCTGGGCTTTGGGTTTGGACTGATCATCTTGTTGGCTGGCGTGATGAGACTGAAGAATGCTAAA
#SharkB_L20275       CATTGCTTCGATCTATTACATAGATGTTTTAACAGCACCGGGGACTATCAGTATGTTTATGACCAGGAGCTGATCGCGTATTATGACTATAACCAGAGGAAGTTCATCGCGGTGAAATGGATGAAGTCTAATGTGGACAGATGGAACGCGCAGTACGAGAGCGCGAAGACTTGTGAACACAACATCCCGAAGCTGGCCCGGCAAGAACCAAAGGTGACAATTCGAACAAAAGAATCGACAGGGCCCATACTCATTTGTGTTGGATTTTACCCAGCAAAGATCAGTGTCACGTGGCTGAAAAATGGACAGAAGGTTTCTGATGCTGATGTCACAGTTGAGTTGTTATCAAATGGTGACTGGACATATCAGGTTCGCCAGTATCTCCAGTATGAGCCAGTGTATGGTGATAAATACACCTGCCATGTGGAACACAGCAGCCTGACCTCACCAATGAGTGTGGATTGGGAAGTAGAGAGTAAATCTGAAAAAACAAAGATCATTGTCGGAGTGCTGGGCTTTGGGTTTGGACTGATCATCTTGTTGGCTGGCGTGATGAGACTGAAGAATGCTAAA

Home | CV | Databases | IMEG Seminars | MEP-online | People | Publications | SoftwareText only version


| Laboratory of Masatoshi Nei |
| Department of Biology | Eberly College of Science |
| Institute of Molecular Evolutionary Genetics | Penn State |
2003 The Pennsylvania State University
This page was last updated 6/5/12 by T. Mazurczyk.