| 1) NELF-A c-ter.3 | 2) NELF-A c-ter.4 | 3) NELF-A HDag.1 | 4) NELF-A HDag.2 | 5) Tailed-4 | 6)
Tailed-5 |
7) |
8 |
| 9) fcp-N1 R1 |
10) fcp-N3 Xho1 |
11) fcp-C1b R1 |
12) fcp-C2b Sal |
13) tat SF1 B.1 | 14) tat SF1 B.2 |
15) tatSF1 N-A 5' |
16) tatSF1 N-A 3' |
| 17) tatSF1 N-B 5' |
18) tatSF1 N-B 3' |
19) tatSF1 rrm 5' |
20) tatSF1 rrm 3' |
21) tatSF1 N-A.2 5’ | 22) tatSF1 N-A.2 3’ | 23) Sfi1-A | 24) Sfi1-B |
| 25) Gal4-fusion A.1 |
26) Gal4-fusion A.2 |
27)
pGEX5' seq primer |
28) pGEX3' seq primer |
29) G-less +35/+10 |
30) G-less +344/+318 |
31)
p70_ +35/+10 |
32) p70_+60/+40 |
| 33) FLAG-NELF-B.1 | 34) FLAG-NELF-B.2 | 35) FLAG-NELF-B.3 | 36) FLAG-NELF-B.4 | 37) NELF-A C-ter.1 | 38) NELF-A C-ter.2 |
39) TR-3 |
40) |
| 41) RNAi-NELF-B.1 | 42) RNAi-NELF-B.2 | 43) RNAi-NELF-B.3 | 44) RNAi-NELF-B.4 | 45) RNAi-NELF-B.5 |
46) NELF-A 3'UTR-1 |
47) NELF-A 3'UTR-2 |
48) NELF-A 3'UTR |
| 49) RNAi-NELF-D.1 |
50) RNAi-NELF-D.2 |
51) RNAi-NELF-D.3 |
52) RNAi-NELF-D.4 |
53) RNAi-NELF-A.1 |
54) RNAi-NELF-A.2 |
55) RNAi-NELF-A.3 |
56) RNAi-NELF-A.4 |
| 57) Tailed-1 | 58) Tailed-2 | 59) Tailed-3 | 60) fcp pd1 | 61) fcp pd2 | 62) fcp brca1 | 63) fcp brca2 | 64) |
Description of contents:
|
|
NELF-A c-ter.3: gcgtagctagcCGTGGACTCTCTCTATCGAA |
|
|
NELF-A c-ter.4: gcctaaagcttGCGTATGACCCTTGTGGA |
|
|
NELF-A HDag.1: gcgtagctagcCTATGGGTTTCCATGCTG |
|
|
NELF-A HDag.2: gcctaaagcttaTTCGGTGAATTCGATCA |
|
|
Tailed-4: 5'- AAG CTT GGG CTG CAG GTC -3'. Zhiqiang is using this to generate a tailed template of ~130 nucs. |
|
|
Tailed-5: 5'- /5Phos/GAT CAA AAA AAA TTA -3'. Zhiqiang is using this to ad a tail that won't bind UpG near its end. |
|
|
|
|
|
|
|
fcp-N1 R1:ATG CGA ATT CCA TGC AGA AGA TAC CGG ACG A, for amplifying N-terminus of FCP1 and inserting it into R1/XhoI cut pGEX-4T3. (Tm=60.6) |
|
|
fcp-N3 Xho1: GAT CCT CGA GCC GTA CAG CTG GAA GTG G, for amplifying N-terminus of FCP1 and inserting it into R1/XhoI cut pGEX-4T3. (Tm=61.8) |
|
|
fcp-C1b R1: GAT CGA ATT CAC CCA CGC AGA TGA AGC TC, for amplifying C-terminus of FCP1 and inserting it into R1/XhoI cut pGEX-4T3. (Tm=60.5) |
|
|
fcp-C2b Sal: GAT CGT CGA CCT ACA TGT CAA AGT CCT CCA GG, for amplifying C-terminus of FCP1 and inserting it into R1/XhoI cut pGEX-4T3. (Tm=58.7) |
|
|
tat SF1 B.1: GAT CGA ATT CCA TGA GCG ACG AAG GTG GC (begins at ~12; Tm=62.4) |
|
|
tat SF1 B.2: GAT CCT CGA GCT TGG TGT TCT GCA ATG G (ends at ~860; Tm=56) |
|
|
tatSF1 N-A 5': TCA GAA TTC GGA CGA AGG TGG CTG TAA ATC, First half of N-terminus preceding the rrm (begins at ~8; Tm=57.3) |
|
|
tatSF1 N-A 3': TAT CTC TCG AGA CGC CAT CCT TGT CGG TGT AA, First half of the N-terminus preceding the rrm (ends at ~556; Tm=66.4) |
|
|
tatSF1 N-B 5': CCA GAA TTC AGG CGT TGA TGA AGA TGT TGA TG, second half of the N-terminus preceding the rrm (begins at ~322; Tm=63.5) |
|
|
tatSF1 N-B 3': TAT CTC TCG AGG CGC TGG ATG CTG GAT TGT CT, second half of the N-terminus preceding the rrm (ends ~780; Tm=67) |
|
|
tatSF1 rrm 5': ATC AGA ATT CAT CCC AGG AGC CCC CAA AAT, amplifies the two rrm (begins ~806; Tm=64.3) |
|
|
tatSF1 rrm 3': TAT CTC TCG AGT AAA ACG ATC GCA GGT AAA TG, amplifies the two rrm (ends ~1700; Tm=57.8) |
|
|
tatSF1 N-A.2 5’: CGGGAATTCGGACGAAGGTGGCTGTAAATC; PCR amplifying the N-terminus of dTat-SF1; This is similar to tatSF1 N-A 5' and was made to try to improve EcoR1 cutting at end. |
|
|
tatSF1 N-A.2 3’: CTGCGCTCGAGACGCCATCCTTGTCGGTG; PCR amplifying the N-terminus of dTat-SF1; This is similar to tatSF1 N-A 3' and was made to try to improve XhoI cutting at end. |
|
|
Sfi1-A: GGC CGC GGC CAT CTA GGC C; insertion of an Sfi1 site into pUAST |
|
|
Sfi1-B: TCG AGG CCT AGA TGG CCG C; insertion of an Sfi1 site into pUAST |
|
|
Gal4-fusion A.1: CCGGAATTCAAAatgaagctactgtcttctatc; This oligo is for amplifying the Gal4-DBD from pCaSpeR-hs Gal4 1-94 and placing a good Kozak sequence next to the ATG. It contains an EcoRI site and allows insertion into pCaSpeR-hs |
|
|
Gal4-fusion A.2: ccaactggtaatggtagcga; This oligo along with Ga4-fusion A.1 is for amplifying the Gal4-DBD from pCaSpeR-hs Gal4 1-94. There will be an XbaI site near the end of the fragment. The PCR product will be cut with EcoR1 and XbaI and inserted into pCaSpeR-hs. |
|
|
pGEX5' seq primer: GGG CTG GCA AGC CAC GTT TGG TG |
|
|
pGEX3' seq primer: CCG GGA GCT GCA TGT GTC AGA GG |
|
|
G-less +35/+10: GGA GTG ATG TGT TTA TTT TGT TTG TT; this oligo is to be used with Larry Benjamins p70 G-less cassette in primer extension assays to monitor polymerase that make it to the promoter proximal region. |
|
|
G-less +344/+318: AAG GAT ATA TGA GAT GAG TAG GGA GTA; this oligo is to be used with Larry's p70 G-less cassette in primer extension assays to monitor polymerase that transcribes well beyond the promoter proximal region. |
|
|
p70_+35/+10: TAG CGA CGT GTT CAC TTT GCT TGT TT; this oligo is to be used on p70 and XBX constructs in primte extension assays to monitor polymerase that transcribes into the promoter proximal region. |
|
|
p70_+60/+40: CTTGTTTATTTGCTTAGCTTT. Tm=48.6. +60 to +40 primer for Vivian's analysis of polymerase release. Note, when I ordered this, I mistyped the name and called it p70_+60/+10. |
|
|
FLAG-NELF-B.1: GCCGAATTCCTGCAGCCCCA; The underlined region matches the 5’ end of the FLAG region in pA5C∆P-Flag-dRD from which we are amplifying the FLAG sequence for the NELF-B subcloning. Note that this does not encode the FLAG sequence but anneals adjacent the FLAG encoding sequence. |
|
|
FLAG-NELF-B.2: CGGTGTGCTCATTATCATATGCTTGTCATCGTCGTCC; The underlined region matches the 3’ end of the FLAG region in pA5C∆P-Flag-dRD from which we are amplifying the FLAG sequence for the NELF-B subcloning. The italics matches the 5’ end of NELF-B in Chwen-Huey’s clone that she obtained from Research Genetics. This oligo provides the connection between the FLAG PCR fragment and the NELF-B coding PCR fragment. |
|
|
FLAG-NELF-B.3: ATGATAATGAGCACACCG; The italics matches the 5’ end of NELF-B in Chwen-Huey’s clone that she obtained from Research Genetics. This is part of the construction of a FLAG-tag NELF-B plasmid |
|
|
FLAG-NELF-B.4: gccagatctCTATTGGACATTATAGTGCG; Lower case contains the BglII site and italics match the 3' end of the NELF-B coding region including the stop codon. This is part of the construction of a FLAG-tag NELF-B plasmid |
|
|
NELF-A C-ter.1: CGCggatccCGTGGACTCTCTCTATCGAA; Meghan Smith, For PCR amplifying sequences encoding amino acids 1150-1248 of NELF-A and making pGEX fusion. |
|
|
NELF-A C-ter.2: CCGgaattcGCGTATGACCCTTGTGGA; Meghan Smith, For PCR amplifying sequences encoding amino acids 1150-1248 of NELF-A and making pGEX fusion. |
|
|
TR-3: CGA CGG GAT CGA TTC CAA TAG GC: this is a fresh preparation of TR-3 for use in ligation mediated PCR analysis of p70 derivatives. |
|
|
|
|
RNAi-NELF-B.1: ggcgaattcCCGACGAATTGCATGATAA; Derived from the 5’ end of the translated region of NELF-B with an appended EcoRI site. This part of the NELF-B RNAi construction. |
|
|
RNAi-NELF-B.2: ccgctcgagCCGACGAATTGCATGATAA; Derived from the 5’ end of the translated region of NELF-B with an appended XhoI site. This part of the NELF-B RNAi construction. |
|
|
RNAi-NELF-B.3: ggcggccatctaggccCAGCGTGCAATAGTGAACAT; Derived from approximately 800 nucleotides from the AUG with an appended SfiI site. This part of the NELF-B RNAi construction. Use this with RNAi-NELF-B.2 |
|
|
RNAi-NELF-B.4: ggcggccaagatggccCAGCGTGCAATAGTGAACAT; Derived from approximately 800 nucleotides from the AUG with an appended SfiI site. This part of the NELF-B RNAi construction. Use this with RNAi-NELF-B.1 |
|
|
RNAi-NELF-B.5: ccgtctagaCCGACGAATTGCATGATAA; Derived from the 5’ end of the translated region of NELF-B with an appended XbaI site. This part of the NELF-B RNAi construction. We switched to an XbaI site because XhoI appeared not to cut the PCR product due to end-sensitivity. Use this with RNAi-NELF-B.3. |
|
|
NELF-A 3'UTR-1: agggacagcagggaaat; For sequencing the junction between the 3’UTR and the putative stop codon for NELF-A |
|
|
NELF-A 3'UTR-2: GTGTGCTTGGATGAATGG; For sequencing the junction between the 3’UTR and the putative stop codon for NELF-A |
|
|
NELF-A 3'UTR: GGTGTTTTTATGGATGTACGAA; For sequencing the junction between the 3’UTR and the putative stop codon for NELF-A |
|
|
RNAi-NELF-D.1: ggcgaattcAAAAATGGAAGTGGAATACGA (51 to 71, 5' region near AUG). Tm for target is 56. Use with RNAi-NELF-D.2. |
|
|
RNAi-NELF-D.2: ggcggccaagatggccGGATAGACTGCCGAACCA (884 to 867, ~800 bp downstream). Tm for target is 56. |
|
|
RNAi-NELF-D.3: ccgtctagaAAAAATGGAAGTGGAATACGA (5' region near AUG). Tm for target is 56. Use with RNAi-NELF-D.4 |
|
|
RNAi-NELF-D.4: ggcggccatctaggccGGATAGACTGCCGAACCA (884
to 867, ~800 bp downstream). Tm for target is 56. |
|
|
RNAi-NELF-A.1: ggcgaattcGCGGACAGGCGTAATTC (192 to 208)
Tm for target is 58. Use with RNAi-NELF-A.2. |
|
|
RNAi-NELF-A.2: ggcggccaagatggccTAATGCCACCGTCTTTGC (983
to 966) Tm for target is 58. |
|
|
RNAi-NELF-A.3: ccgtctagaGCGGACAGGCGTAATTC (192 to
208) Tm for target is 58. Use with RNAi-NELF-A.4. |
|
|
RNAi-NELF-A.4: ggcggccatctaggccTAATGCCACCGTCTTTGC (983
to 966) Tm for target is 58. |
|
|
Tailed-1: 5'- GGC AGA TCT TAT CCT CTC CTC ACC TCT C -3'. Zhiqiang will use this to make a tailed template from p70 G-less. |
|
|
Tailed-2: 5'- /5Bio/CAC CCC AGG CTT TAC ACT T -3'. Zhiqiang will use this to make a tailed template from p70 G-less. |
|
|
Tailed-3: 5'- /5Phos/GAT CAA AAA AAA CCA -3'. Zhiqiang will use this to make a tailed template from p70 G-less. |
|
|
fcp pd1: GCT ATG CTA GCG GGC ACG ACG ACA CC; for subcloning phosphatase domain of fcp1 into pET28a. |
|
|
fcp pd2: CCT AAA AGC TTA GTC CCC ATG CTT CTC; for subcloning phosphatase domain of fcp1 into pET28a. |
|
|
fcp brca1: GCT TAG CTA GCA TTC GGA GCG AAG TG; for subcloning BRCA1 domain of fcp1 into pET28a. |
|
|
fcp brca2: CCA TAA AGC TTA TAC CTT GCG GTC CAG T; for subcloning BRCA1 domain of fcp1 into pET28a. |
|
|
(return to top)